ID: 968962870

View in Genome Browser
Species Human (GRCh38)
Location 4:3753975-3753997
Sequence AACCAGGAAGGGTGCCTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968962858_968962870 15 Left 968962858 4:3753937-3753959 CCTCCAAGACCGCGGCAGGCGGG No data
Right 968962870 4:3753975-3753997 AACCAGGAAGGGTGCCTCCTCGG No data
968962863_968962870 6 Left 968962863 4:3753946-3753968 CCGCGGCAGGCGGGGGTCCTGTG No data
Right 968962870 4:3753975-3753997 AACCAGGAAGGGTGCCTCCTCGG No data
968962862_968962870 12 Left 968962862 4:3753940-3753962 CCAAGACCGCGGCAGGCGGGGGT No data
Right 968962870 4:3753975-3753997 AACCAGGAAGGGTGCCTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968962870 Original CRISPR AACCAGGAAGGGTGCCTCCT CGG Intergenic