ID: 968962874

View in Genome Browser
Species Human (GRCh38)
Location 4:3753989-3754011
Sequence CCTCCTCGGTCATGAAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968962858_968962874 29 Left 968962858 4:3753937-3753959 CCTCCAAGACCGCGGCAGGCGGG No data
Right 968962874 4:3753989-3754011 CCTCCTCGGTCATGAAAAGGAGG No data
968962862_968962874 26 Left 968962862 4:3753940-3753962 CCAAGACCGCGGCAGGCGGGGGT No data
Right 968962874 4:3753989-3754011 CCTCCTCGGTCATGAAAAGGAGG No data
968962866_968962874 3 Left 968962866 4:3753963-3753985 CCTGTGACCTGGAACCAGGAAGG No data
Right 968962874 4:3753989-3754011 CCTCCTCGGTCATGAAAAGGAGG No data
968962869_968962874 -4 Left 968962869 4:3753970-3753992 CCTGGAACCAGGAAGGGTGCCTC No data
Right 968962874 4:3753989-3754011 CCTCCTCGGTCATGAAAAGGAGG No data
968962863_968962874 20 Left 968962863 4:3753946-3753968 CCGCGGCAGGCGGGGGTCCTGTG No data
Right 968962874 4:3753989-3754011 CCTCCTCGGTCATGAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968962874 Original CRISPR CCTCCTCGGTCATGAAAAGG AGG Intergenic