ID: 968962876

View in Genome Browser
Species Human (GRCh38)
Location 4:3754007-3754029
Sequence GGAGGAATGTGCCTCCTCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968962866_968962876 21 Left 968962866 4:3753963-3753985 CCTGTGACCTGGAACCAGGAAGG No data
Right 968962876 4:3754007-3754029 GGAGGAATGTGCCTCCTCGCAGG No data
968962871_968962876 7 Left 968962871 4:3753977-3753999 CCAGGAAGGGTGCCTCCTCGGTC No data
Right 968962876 4:3754007-3754029 GGAGGAATGTGCCTCCTCGCAGG No data
968962869_968962876 14 Left 968962869 4:3753970-3753992 CCTGGAACCAGGAAGGGTGCCTC No data
Right 968962876 4:3754007-3754029 GGAGGAATGTGCCTCCTCGCAGG No data
968962875_968962876 -8 Left 968962875 4:3753992-3754014 CCTCGGTCATGAAAAGGAGGAAT No data
Right 968962876 4:3754007-3754029 GGAGGAATGTGCCTCCTCGCAGG No data
968962873_968962876 -5 Left 968962873 4:3753989-3754011 CCTCCTCGGTCATGAAAAGGAGG No data
Right 968962876 4:3754007-3754029 GGAGGAATGTGCCTCCTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968962876 Original CRISPR GGAGGAATGTGCCTCCTCGC AGG Intergenic