ID: 968963433

View in Genome Browser
Species Human (GRCh38)
Location 4:3757440-3757462
Sequence AGTGTGGGCAGGCCCACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968963433_968963445 23 Left 968963433 4:3757440-3757462 CCACCTGTGGGCCTGCCCACACT No data
Right 968963445 4:3757486-3757508 TTCCACGCGGGCACGAGAGCAGG No data
968963433_968963442 11 Left 968963433 4:3757440-3757462 CCACCTGTGGGCCTGCCCACACT No data
Right 968963442 4:3757474-3757496 CACGCCCACACTTTCCACGCGGG No data
968963433_968963441 10 Left 968963433 4:3757440-3757462 CCACCTGTGGGCCTGCCCACACT No data
Right 968963441 4:3757473-3757495 GCACGCCCACACTTTCCACGCGG No data
968963433_968963447 26 Left 968963433 4:3757440-3757462 CCACCTGTGGGCCTGCCCACACT No data
Right 968963447 4:3757489-3757511 CACGCGGGCACGAGAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968963433 Original CRISPR AGTGTGGGCAGGCCCACAGG TGG (reversed) Intergenic