ID: 968963604

View in Genome Browser
Species Human (GRCh38)
Location 4:3758221-3758243
Sequence TGGGTCAGTAGAGGATGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968963596_968963604 10 Left 968963596 4:3758188-3758210 CCCAGGTTAGGGAGGTCTAGGGG No data
Right 968963604 4:3758221-3758243 TGGGTCAGTAGAGGATGCACTGG No data
968963589_968963604 24 Left 968963589 4:3758174-3758196 CCAGGGGACAGCCACCCAGGTTA No data
Right 968963604 4:3758221-3758243 TGGGTCAGTAGAGGATGCACTGG No data
968963593_968963604 13 Left 968963593 4:3758185-3758207 CCACCCAGGTTAGGGAGGTCTAG No data
Right 968963604 4:3758221-3758243 TGGGTCAGTAGAGGATGCACTGG No data
968963598_968963604 9 Left 968963598 4:3758189-3758211 CCAGGTTAGGGAGGTCTAGGGGT No data
Right 968963604 4:3758221-3758243 TGGGTCAGTAGAGGATGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968963604 Original CRISPR TGGGTCAGTAGAGGATGCAC TGG Intergenic