ID: 968963716

View in Genome Browser
Species Human (GRCh38)
Location 4:3758879-3758901
Sequence CAGCCCTGGGTACCTGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 271}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968963716_968963728 9 Left 968963716 4:3758879-3758901 CCCAAGCCAGGTACCCAGGGCTG 0: 1
1: 0
2: 3
3: 36
4: 271
Right 968963728 4:3758911-3758933 GGGGCGTTGGCAGAGGCAGTTGG 0: 1
1: 0
2: 0
3: 22
4: 321
968963716_968963722 -10 Left 968963716 4:3758879-3758901 CCCAAGCCAGGTACCCAGGGCTG 0: 1
1: 0
2: 3
3: 36
4: 271
Right 968963722 4:3758892-3758914 CCCAGGGCTGCCCAGTGCAGGGG 0: 1
1: 1
2: 10
3: 149
4: 781
968963716_968963727 2 Left 968963716 4:3758879-3758901 CCCAAGCCAGGTACCCAGGGCTG 0: 1
1: 0
2: 3
3: 36
4: 271
Right 968963727 4:3758904-3758926 CAGTGCAGGGGCGTTGGCAGAGG 0: 1
1: 0
2: 9
3: 25
4: 327
968963716_968963724 -4 Left 968963716 4:3758879-3758901 CCCAAGCCAGGTACCCAGGGCTG 0: 1
1: 0
2: 3
3: 36
4: 271
Right 968963724 4:3758898-3758920 GCTGCCCAGTGCAGGGGCGTTGG 0: 1
1: 0
2: 0
3: 20
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968963716 Original CRISPR CAGCCCTGGGTACCTGGCTT GGG (reversed) Intergenic
900381829 1:2388081-2388103 AAGCCCTGGGGACCTGACTGAGG - Intronic
900979396 1:6037791-6037813 CAAGGCTGGTTACCTGGCTTTGG - Intronic
902150052 1:14435612-14435634 CAGCCCTGGGGACCAGGGTCTGG - Intergenic
902326431 1:15703830-15703852 GAGCCCTGTGCTCCTGGCTTTGG + Intronic
902405977 1:16183831-16183853 CAGCCCGGGGCTCCAGGCTTGGG - Intergenic
902986398 1:20156949-20156971 TAGTCCTTGGTCCCTGGCTTGGG - Intergenic
903929513 1:26854248-26854270 CAGCTCTGGATAGCTGGCTGTGG + Exonic
904585694 1:31579472-31579494 CAGCCATGGGTGCCTGGCCCAGG + Intronic
904813556 1:33179742-33179764 CAGCCCCATGTACCTGGCTTTGG - Intronic
904832076 1:33311822-33311844 CAGCCCTGGCTGCCTGTGTTGGG + Intronic
904863611 1:33559363-33559385 CAACCCTGGGTATATGGCTGAGG - Exonic
905415731 1:37802635-37802657 CAGGCCTGGCCACCTGGCTTTGG + Intergenic
905704267 1:40042358-40042380 GAACCCTGGGCACCTGGCTCAGG - Intronic
907268252 1:53275734-53275756 CAGCACTGGGCACCTGCCGTGGG - Exonic
907486336 1:54780850-54780872 CAGGCCTGAGTGCCTGTCTTTGG - Exonic
909611844 1:77559115-77559137 CAGCCCTGGGCATCTTCCTTTGG + Exonic
911973589 1:104465236-104465258 TAGTCCTTGGTCCCTGGCTTGGG + Intergenic
913591760 1:120335712-120335734 GAGCCCTGGGAACCTGCCTCAGG - Intergenic
913651595 1:120919433-120919455 GAGCCCTGGGAACCTGCCTCAGG + Intergenic
914169511 1:145209637-145209659 GAGCCCTGGGAACCTGCCTCAGG - Intergenic
914524623 1:148453599-148453621 GAGCCCTGGGAACCTGCCTCAGG - Intergenic
914599048 1:149182234-149182256 GAGCCCTGGGAACCTGCCTCAGG + Intergenic
914641776 1:149613541-149613563 GAGCCCTGGGAACCTGCCTCAGG + Intergenic
914997856 1:152560631-152560653 CAGCCCATGGTACCTGCCTCTGG + Intronic
915213682 1:154326952-154326974 CAGTCCAGGGTGCCTGGCTCAGG - Intronic
918006209 1:180544174-180544196 CAGCCCTGATTGACTGGCTTGGG - Intergenic
918074946 1:181162950-181162972 CAGCTGTGTGTACCTGGCTCAGG + Intergenic
918647416 1:186919854-186919876 TAGTCCTTGGTCCCTGGCTTAGG + Intronic
921747171 1:218752134-218752156 TAGTCCTTGGTCCCTGGCTTGGG + Intergenic
922463168 1:225828381-225828403 CAGCCCTGGGTAGGGGGTTTTGG - Intronic
1063340920 10:5262390-5262412 CAGCCCTGGAAAGCTGGCTTTGG + Intergenic
1064680814 10:17809356-17809378 CAGCTCTGGGAACTTGGATTAGG + Exonic
1066390184 10:34972041-34972063 TAGTCCTTGGTCCCTGGCTTGGG - Intergenic
1067429644 10:46234570-46234592 CAGCCCTGGGTCTCTGACTCTGG + Intergenic
1067802532 10:49368947-49368969 TAGCCCTGGGTAGCTGGCCCTGG + Intronic
1070526506 10:77300115-77300137 CTGCACAGGGTACCTGGCTTAGG - Intronic
1070895979 10:79983148-79983170 CATCTCTGGCTCCCTGGCTTGGG + Intergenic
1071282011 10:84111709-84111731 TAGTCCTTGGTCCCTGGCTTAGG - Intergenic
1071566212 10:86672704-86672726 CAGCCCGGAGGACCTGGCCTGGG - Intronic
1077305308 11:1866322-1866344 CAGCACTGAGTGCCTGGCCTGGG - Intronic
1078070847 11:8108866-8108888 GAGCCCTGGGTTCCTGGCTCAGG - Intronic
1078463532 11:11533356-11533378 CAGACCTGGGTACCTGGGTTTGG - Intronic
1079080124 11:17408206-17408228 CTGCCCTGGGCACCTGGCACAGG + Intronic
1079244012 11:18740162-18740184 CACCCCTGGGGCCCTAGCTTAGG - Intronic
1079492199 11:21001475-21001497 CAGCCCTGGGCAGCAGGCTAAGG + Intronic
1082749086 11:56998689-56998711 CAGACCTGGATACCTGGGTATGG - Intergenic
1082804411 11:57438445-57438467 CTGCCCTAGCTGCCTGGCTTTGG - Intergenic
1083197963 11:61102302-61102324 CAGCCCTGGGTACCTTGGGCAGG + Intergenic
1083894697 11:65614053-65614075 CAGTCCTGGGAGCCTGGCTCCGG + Exonic
1085023118 11:73221473-73221495 CTGCCCTGGGAACCTGTGTTTGG + Intronic
1086267198 11:85014785-85014807 CTGTCCAGGGTACCTGTCTTGGG + Intronic
1086968584 11:93055923-93055945 CAGCTTTGGCTACCTGGCTATGG + Intergenic
1089312206 11:117566002-117566024 GAGCTCTGAGAACCTGGCTTAGG - Intronic
1089693935 11:120204713-120204735 TAGCCCTGTGTACCTGGCACTGG - Intergenic
1090412279 11:126517545-126517567 CAGCCCTGGGGTCCTGGCCTTGG - Intronic
1090733791 11:129593757-129593779 CAGACCTGGGTACAAGACTTGGG + Intergenic
1090876293 11:130791616-130791638 CAGCCCTGGGAACATGGGGTAGG + Intergenic
1092251921 12:6904236-6904258 CAGGCCTGAGTGCCTGGGTTTGG + Intronic
1096509233 12:52118362-52118384 TAGTCCTTGGTCCCTGGCTTGGG + Intergenic
1096529590 12:52234372-52234394 CAGCCCTGAGTTCCTGGCTTTGG - Intronic
1097189617 12:57213141-57213163 CAGCCCTGGGAACCTCGGTGGGG - Exonic
1098748416 12:74267570-74267592 TAGTCCTTGGTCCCTGGCTTAGG - Intergenic
1101029467 12:100645358-100645380 TAGTCCTTGGTCCCTGGCTTAGG + Intergenic
1102557948 12:113741235-113741257 CCTCCCTGGGAACCTGGCTCAGG - Intergenic
1102774674 12:115508169-115508191 CACCCCTGGGAAGCTGGCCTGGG - Intergenic
1104292679 12:127484078-127484100 TAGTCCTTGGTCCCTGGCTTGGG - Intergenic
1104728519 12:131092606-131092628 CAGGCATGGGCACCTGCCTTGGG + Intronic
1104919568 12:132283516-132283538 CAGCCCTGCTCACCTGGCCTTGG + Intronic
1104936187 12:132365624-132365646 CAGCCCTGGGTTTCTGGCCCAGG + Intergenic
1104936274 12:132366037-132366059 CAGCCCTGGGTTTCTGGCCCAGG + Intergenic
1105708100 13:22981341-22981363 CAGCCCTGGATTCCTGGATGAGG - Intergenic
1106182574 13:27381501-27381523 AAGGCCTGGGTACCTGGCCGTGG + Intergenic
1106658833 13:31777078-31777100 CACCTCTGGGTACCTGGGTCTGG - Intronic
1107420139 13:40238478-40238500 CTGACTTGGGTACCTGGGTTGGG - Intergenic
1108699050 13:52928088-52928110 GAGCACTGGGTACCTGGGATTGG + Intergenic
1113375753 13:109764288-109764310 TAGCCCTGGGGACCCGGCTCTGG - Intronic
1117744992 14:58860457-58860479 CACCCCTGGCTACCTGCCTGTGG - Intergenic
1119376267 14:74196143-74196165 CAGCTCTGTGTACTTGGATTAGG + Intronic
1119868086 14:77990810-77990832 CAGCCCAGGGTGGCTGGGTTAGG + Intergenic
1120865352 14:89291604-89291626 CTGCCCTGGGGTCCTGTCTTTGG + Intronic
1121619710 14:95337620-95337642 CAGCCCTGGGTGCTGGGCTCAGG + Intergenic
1122666869 14:103335663-103335685 CAGCCATTGGTACCTGTATTGGG + Exonic
1122806966 14:104264695-104264717 CAGTGCTGGGTGCCGGGCTTGGG + Intergenic
1122938236 14:104969816-104969838 CAGCCCAGGGAAACTGGCTCAGG - Intronic
1122976027 14:105171101-105171123 CAGTCCTGGGGACCAGGCTGAGG + Intergenic
1123180879 14:106469060-106469082 CAGCCCTGGGTGCCTGGGTCAGG - Intergenic
1202946017 14_KI270726v1_random:27598-27620 CAGCCCTGGGTGCCTGGGTCAGG + Intergenic
1123999194 15:25740697-25740719 CACCTCTGTCTACCTGGCTTTGG + Intronic
1125521054 15:40347999-40348021 CAGCCCTGGGGACCTGCCTGCGG - Intergenic
1126996733 15:54452763-54452785 CAGCCATAGGTAGCTGGCTGGGG + Intronic
1128684127 15:69671204-69671226 CACCCCTGGCTCCCTGACTTGGG - Intergenic
1128841299 15:70853664-70853686 CAGCCCTGGGAGCCTCGGTTGGG + Intronic
1128945089 15:71814363-71814385 CAACCCTCAGTACCTGGCTAGGG - Intronic
1129053357 15:72800869-72800891 CAGACCAGGGTGGCTGGCTTCGG - Intergenic
1129561228 15:76571748-76571770 CTTCACTGGGTACCTGGCTTTGG + Intronic
1129976506 15:79826634-79826656 AAGCCCAGGGTACTTGGCTTGGG - Intergenic
1131147107 15:90021061-90021083 CAGCCCTGGGTTCCTTGCTATGG + Intronic
1132655953 16:1041720-1041742 CTGCCCTGGGTGCCAGGCCTAGG + Intergenic
1132856586 16:2047766-2047788 CAGCCCCGGGTCCCAGGCTCCGG + Exonic
1133014371 16:2932581-2932603 CTGCCCTGGGCACCTGGGGTGGG + Intronic
1135503396 16:23016218-23016240 CAGCCCTGGAGAGCTTGCTTTGG - Intergenic
1137589606 16:49685580-49685602 GATCCCTGGTTTCCTGGCTTGGG - Intronic
1137748596 16:50841762-50841784 CAGGCCTGGCCACCTGGCTTGGG + Intergenic
1138189574 16:55003487-55003509 CAGCCCTGGGCCTCTGGCTCTGG + Intergenic
1138346705 16:56324648-56324670 CAGCCCTGGGGCCTGGGCTTTGG - Intronic
1138512175 16:57515164-57515186 CTGCCCTGGTTTCCTGGCTCTGG + Intronic
1139569495 16:67802149-67802171 CTGCCCTGTGTAACTGCCTTTGG + Intronic
1139847226 16:69929584-69929606 CAGCACTGGGCAGGTGGCTTTGG + Intronic
1141204502 16:81923252-81923274 GAGCCAAGGGTACCTGGGTTGGG - Intronic
1141750965 16:85957553-85957575 AAGCCCTGGGGACAAGGCTTAGG - Intergenic
1142144585 16:88487593-88487615 CAGACCTTGGTCCCTGGCTTGGG + Intronic
1142233082 16:88908952-88908974 GGGCCCTGGGCACCTGGCTCTGG + Intronic
1142536778 17:623101-623123 CAGGCCTGTATACCTGGCTTTGG + Intronic
1143034899 17:3989207-3989229 CAGCCCAGGGCAGCTGGCCTCGG + Intergenic
1144081721 17:11769335-11769357 CAGCCCAGGGCACCTGGGGTGGG + Intronic
1144206979 17:12986361-12986383 CAGCCCTGGAGACCTGGCTCGGG - Intronic
1144771165 17:17760442-17760464 CAGCCCAGTGTCCCTGGCCTGGG + Intronic
1145238866 17:21227940-21227962 GAGCCCTTGGTGCCTGGCTTAGG + Intergenic
1146399914 17:32494300-32494322 CAGCCCTGGGGACCCAGCTCAGG - Exonic
1146721889 17:35129701-35129723 AAGCCCTGGTTCCCTGGCTTTGG - Intronic
1147557247 17:41487232-41487254 CAGCCCTGGGCATCTGCCTACGG + Intronic
1148333107 17:46823830-46823852 CATCTCTGAGTCCCTGGCTTCGG + Intronic
1148807293 17:50270445-50270467 CAGCCCAGGGGGCCAGGCTTGGG - Intergenic
1148846703 17:50533897-50533919 CAGCCCTGGGCAGCTGGGTATGG - Intronic
1149660885 17:58333378-58333400 CAGCCCAGGGCCCCTGGCTGGGG + Intergenic
1149970272 17:61211038-61211060 CAGCGCTGGGACCCTAGCTTGGG - Intronic
1151660543 17:75516019-75516041 CGGCCCTCGAAACCTGGCTTCGG + Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1151910340 17:77078679-77078701 CAGTACTTGGTACCCGGCTTCGG + Intergenic
1152079183 17:78175853-78175875 GAGTCCTGGGTACCTGGACTCGG - Intronic
1152365922 17:79856235-79856257 CAGCCCTGGGCACGTGCCCTGGG + Intergenic
1152523037 17:80871487-80871509 CTGGCCTGGGTCCCTGGCTGAGG + Intronic
1152559070 17:81068826-81068848 CAGCCTTGCGTTCCTGGCTGTGG + Intronic
1152689933 17:81713355-81713377 CTGCCCTGTGAACCTGGCTGTGG + Intronic
1152791513 17:82282803-82282825 CAGCCCTGCGTCCCTGGCTCAGG + Intergenic
1158292012 18:55953658-55953680 TAGTCCTTGGTCCCTGGCTTAGG - Intergenic
1161204811 19:3035485-3035507 CAGCCCCTGGTTCCTGGCTAGGG + Intronic
1161964774 19:7541803-7541825 CAGACCTGGGTACCCCGCTATGG - Intronic
1162068916 19:8142150-8142172 CAGATGTGGGTACCTGGCTGAGG + Intronic
1162284428 19:9727620-9727642 TAGTCCTTGGTCCCTGGCTTAGG + Intergenic
1162380989 19:10331879-10331901 CACCCATGGGTACCTGACTGGGG + Intronic
1162457452 19:10794309-10794331 CAGCCCTGGGTGCTAGGATTTGG + Intronic
1162463815 19:10829366-10829388 CAGCCCTGGGTGCCACCCTTGGG - Intronic
1162566785 19:11448980-11449002 CAGCCTTGGGTGAGTGGCTTGGG + Exonic
1163943426 19:20515328-20515350 TAGTCCTTGGTCCCTGGCTTAGG + Intergenic
1164160066 19:22620550-22620572 CAGCCCTGAGTACCCGGCAAAGG - Intergenic
1164480826 19:28609788-28609810 TAGTCCTTGGTCCCTGGCTTGGG - Intergenic
1164596107 19:29531314-29531336 TGGCCCTGGGAGCCTGGCTTTGG + Intronic
1165073240 19:33267665-33267687 CAGCTCTGGGTTCCTGGAGTGGG - Intergenic
1165494288 19:36142573-36142595 CCACCCAGGGTACCTGGGTTTGG + Intronic
1165935265 19:39385052-39385074 TGGCCCTGGGAACCTGGCTCTGG + Intronic
1168586854 19:57600629-57600651 CATCCCTGGACACCTGGCTCTGG + Intronic
1168712759 19:58511377-58511399 CAGCCCTGTGTATGTGGCTGGGG - Exonic
926058828 2:9792695-9792717 CAGACCTGCGAACCTGGCTTCGG + Intergenic
926087675 2:10030235-10030257 CAGCCCTGATTGCCTGCCTTAGG + Intergenic
929765767 2:44842991-44843013 CATCCCAGGGAACCAGGCTTGGG - Intergenic
931471671 2:62544835-62544857 CTGCCCTGGGCCCCAGGCTTTGG + Intergenic
932562663 2:72887139-72887161 CAGCGCTGGGAACCGGGCTAGGG + Intergenic
935809555 2:106783862-106783884 CTGTCCTGTGTACCAGGCTTTGG + Intergenic
937126009 2:119475428-119475450 CAGCTCTGGGCACCTGGCCTGGG - Intronic
938017155 2:127876596-127876618 GAGCCCAGGCCACCTGGCTTTGG - Intronic
938043004 2:128091406-128091428 CACCCCTGGGTACCTGTCACCGG - Exonic
941010895 2:160298212-160298234 CAGTCCTGGGTTTCTAGCTTGGG + Intronic
942932576 2:181513383-181513405 GAGCCCTAGGTTTCTGGCTTTGG - Intronic
943096868 2:183439722-183439744 GAGACCTGGGTTCCTGGCTCAGG + Intergenic
945297020 2:208180490-208180512 CAGCAATGAGTACCAGGCTTGGG - Intronic
946187811 2:217991080-217991102 CAGCCCTGGGTAGAAGGCTGGGG + Intronic
947282851 2:228475093-228475115 CACCCCTGAGTATGTGGCTTGGG - Intergenic
947543755 2:230996130-230996152 CTGCCCTAGGAGCCTGGCTTGGG - Exonic
948317850 2:237043037-237043059 CAGCCCTGCAGACCTGGCTTTGG + Intergenic
948640289 2:239371690-239371712 CAGCACAGGGGACCTGGCTCAGG + Intronic
948928367 2:241114986-241115008 CAGGCCTGGGTGCCTGGGTCCGG - Intronic
1171127457 20:22614982-22615004 CAGCCCTGTGAACCAGCCTTTGG - Intergenic
1171266332 20:23774962-23774984 GAGCCCTGGGAACCAGGCTGTGG + Intergenic
1172129274 20:32645047-32645069 AGGCCCTGAGAACCTGGCTTAGG - Intergenic
1172468122 20:35172116-35172138 CGGACCTGGGTTCCTGGCTCGGG - Exonic
1172836554 20:37877110-37877132 CAGCCCAGGTTTCCTGGCTAGGG + Intergenic
1172905898 20:38369066-38369088 CAGCCCTGGGAATCTGTCTGTGG + Exonic
1173053904 20:39592593-39592615 AAGCCCTGGCTACGTGACTTGGG - Intergenic
1173362392 20:42356285-42356307 CAACCCTGGGCTCCTGGCATGGG + Intronic
1174529531 20:51199921-51199943 CAGCCCTGGGTTCCTGCACTCGG - Intergenic
1175946172 20:62559793-62559815 CATCCCTGAGGTCCTGGCTTAGG + Intronic
1175988373 20:62775663-62775685 CAGCCCTGGGTCTCTGCCTCAGG + Intergenic
1176229597 20:64025373-64025395 CAGCCCTGGGCACCGGGCTGGGG + Intronic
1176243833 20:64087998-64088020 CAGGCCTGGTCACCTGGCTAGGG - Intronic
1179732695 21:43376372-43376394 GAGCCCTGGGTACCTGGCCCTGG + Intergenic
1180835228 22:18926384-18926406 AAGTCCTGGGCCCCTGGCTTGGG + Intronic
1181259631 22:21588082-21588104 CAGCCCTGAGCAGCTGACTTGGG + Intronic
1181581217 22:23829143-23829165 CAGCCCTGTGTTCCTGGCCAGGG + Intronic
1181711786 22:24695907-24695929 AAGTCCTGGGCCCCTGGCTTGGG + Intergenic
1182318571 22:29463842-29463864 CAGGGCTGGGGACCTGGCCTGGG - Intergenic
1182420239 22:30245411-30245433 CCCCCATGGGTGCCTGGCTTCGG - Intronic
1182881702 22:33739246-33739268 CAGCCTGGGATGCCTGGCTTTGG + Intronic
1183605559 22:38865314-38865336 TAGGCCTGGGGACCAGGCTTGGG - Exonic
1184554339 22:45225135-45225157 CAGCCCTGGCTGCCTGGGTGCGG - Intronic
1184848294 22:47102422-47102444 CAGCCCTGGGCACCTGGCCTTGG - Intronic
1184912900 22:47548025-47548047 CCGCCCTGGCTTCCTGGCATGGG + Intergenic
1203285316 22_KI270734v1_random:151683-151705 AAGTCCTGGGCCCCTGGCTTGGG + Intergenic
949590400 3:5488078-5488100 CAGCCCAGGGCACCTGGCTGAGG + Intergenic
949895859 3:8767253-8767275 CAGCCCTGGCTACCTTCCTTGGG + Exonic
950230386 3:11271047-11271069 CAGCCTTGTTTACCTGCCTTTGG + Intergenic
950306129 3:11916240-11916262 CAGCCATGGGGAGCAGGCTTAGG + Intergenic
950460815 3:13121361-13121383 CAGCCGTGGGTTCCTCACTTGGG - Intergenic
954460238 3:50622428-50622450 CTGCCCAGAGTTCCTGGCTTTGG + Intronic
954992674 3:54854649-54854671 GAGCCCTGGGTGCCTTGCCTGGG + Intronic
957545324 3:81629652-81629674 GAGCCCTGGAAACCTGGCTAGGG + Intronic
957572662 3:81968364-81968386 CAGCCCATGGTACCTGGTTTTGG + Intergenic
960952676 3:123009850-123009872 GAGGCCTTGGTGCCTGGCTTTGG + Intronic
962732830 3:138299276-138299298 CAGCCCCTGGCTCCTGGCTTTGG + Intronic
962806907 3:138934195-138934217 CAGCCCTGAGGACCTGGATCCGG + Intergenic
962971865 3:140408718-140408740 CTTCCCTGGGTTCCTGGGTTGGG - Intronic
964958531 3:162393342-162393364 CAGCCCTGGGAACCTATTTTGGG - Intergenic
966824655 3:183953501-183953523 CACCCCTAGGGACCTGGCTGAGG + Intronic
968451569 4:678485-678507 CAGGCCTGGGTAGCTGGGGTTGG - Intronic
968578860 4:1380445-1380467 GACACCTGGGTACATGGCTTGGG + Intronic
968963716 4:3758879-3758901 CAGCCCTGGGTACCTGGCTTGGG - Intergenic
969114799 4:4864875-4864897 GAAACCTGGGTACCTGGCGTTGG + Intergenic
969339201 4:6529748-6529770 CAGCCCTGGGTCAGTGGCTGGGG - Intronic
969413767 4:7045731-7045753 CAGCCCTTGGCAGTTGGCTTTGG + Intronic
971639920 4:29117879-29117901 CAGCACTGGGTATCTAGCTCAGG + Intergenic
972077268 4:35103778-35103800 TAGTCCTTGGTCCCTGGCTTGGG - Intergenic
975147968 4:70991333-70991355 CAGCCTTGACTCCCTGGCTTCGG + Intronic
976970230 4:91094499-91094521 TAGTCCTTGGTCCCTGGCTTGGG + Intronic
980779931 4:137481559-137481581 TAGTCCTTGGTCCCTGGCTTAGG - Intergenic
981257774 4:142683438-142683460 CAGCACAGAGTATCTGGCTTTGG + Intronic
981604767 4:146529167-146529189 TAGTCCTTGGTCCCTGGCTTGGG - Intergenic
983187095 4:164712545-164712567 CAGCTCTCGGTTCCTTGCTTGGG + Intergenic
983464982 4:168075827-168075849 CAGCCTTGGATCCCTGGCTGGGG - Intergenic
984999867 4:185471876-185471898 CTTCCCTGGGAACCTGGCCTGGG + Intronic
985618412 5:938400-938422 CAGCCCAGTGGCCCTGGCTTTGG + Intergenic
985823982 5:2179491-2179513 AAGCCCTGTGATCCTGGCTTTGG - Intergenic
990299431 5:54435850-54435872 CAGCCCTGGGTGACTGTCTGTGG - Intergenic
990987562 5:61654997-61655019 CAGCCCTGGCTCCTGGGCTTTGG + Intronic
991583836 5:68182832-68182854 CAGCCCTGTGTTCCTGACCTAGG - Intergenic
992124611 5:73627048-73627070 CGGCCCTGGATACCCAGCTTTGG + Intronic
992388742 5:76311254-76311276 CAGCACTGGGAAGCTGGCCTTGG - Intronic
993475335 5:88357594-88357616 CAGGCCTTTGTCCCTGGCTTTGG - Intergenic
995063652 5:107837833-107837855 CTGCCCTTGATGCCTGGCTTTGG + Intergenic
995473620 5:112527156-112527178 TAGTCCTTGGTCCCTGGCTTAGG - Intergenic
997205985 5:132050477-132050499 CAGGCCTGGATACCTGGCTCAGG - Intergenic
997529571 5:134573566-134573588 CAGCTCTGGGGACCTTGCTATGG - Intronic
1000285982 5:159826508-159826530 CGGCCCTGGGAACCTGGGATGGG + Intergenic
1001406279 5:171479804-171479826 CAGCCCTGGGCACGTGGCAGGGG - Intergenic
1001555221 5:172632507-172632529 CAGCTCTGGGCCCCTGGCTTGGG - Intergenic
1002408390 5:179054153-179054175 TAGTCCTTGGTCCCTGGCTTGGG + Intergenic
1002434816 5:179224790-179224812 CAGACCTGGGGACCCAGCTTTGG - Intronic
1002602392 5:180361524-180361546 AAGCCCTGAGAACCTGGCTCAGG + Intergenic
1002769734 6:280873-280895 TAACTCTGGGTTCCTGGCTTAGG - Intergenic
1004274605 6:14224660-14224682 CAGTGCTGGTTACTTGGCTTTGG - Intergenic
1006278372 6:33024837-33024859 CAGCACTTGTTACCTGCCTTTGG + Intergenic
1006301080 6:33193751-33193773 CAGCCCTGGGCACATAGCATAGG - Exonic
1006748668 6:36363095-36363117 CAGAGCTGCATACCTGGCTTAGG - Intronic
1007423317 6:41732866-41732888 CAGCACTTGGGGCCTGGCTTGGG - Intronic
1011556426 6:88574893-88574915 CAGGCCTGGGTATTTGCCTTGGG - Intergenic
1011565124 6:88665439-88665461 TAGTCCTTGGTCCCTGGCTTGGG - Intronic
1012206447 6:96466630-96466652 CTGTCTTGGGTACCTGCCTTTGG + Intergenic
1012219787 6:96635246-96635268 CAGCCCTGTGAAGCTGGCTGGGG - Intergenic
1014162571 6:118186879-118186901 AAACCCTGGGAAGCTGGCTTTGG - Intronic
1014546968 6:122745975-122745997 TAGTCCTTGGTCCCTGGCTTAGG + Intergenic
1014761035 6:125357008-125357030 TGGCCCTCGGTGCCTGGCTTGGG + Intergenic
1014772793 6:125476027-125476049 CATCCCTAGGTACATGGCTGAGG + Intergenic
1016465419 6:144320407-144320429 CAGACCTGGTAACCTGGATTGGG - Intronic
1017758688 6:157551394-157551416 CAGGCCTGGGACCCTGGCATGGG + Intronic
1017866932 6:158452066-158452088 CAGCTTTGGGAACCTGGATTTGG + Intronic
1018173681 6:161161519-161161541 CAGCACTGGGTATCTGCCATAGG + Intronic
1019210509 6:170401123-170401145 CAGCCCTGGGTCCCTGCCAGGGG + Intronic
1019406543 7:887069-887091 CCGCTCTGGGTACCTGGCTCTGG - Intronic
1019482919 7:1274634-1274656 CGGCCCAGGGTGCCTGGCTGTGG - Intergenic
1019932848 7:4235077-4235099 CAGGCCAGGGTACCAGGCTTAGG - Intronic
1020105465 7:5420503-5420525 CAGCCTTGGGACCCTGGCCTCGG - Intronic
1020114780 7:5470361-5470383 CTGCGCTGGGTACCCGCCTTGGG - Intronic
1022470342 7:30678103-30678125 CTGCCCTGTGTTCTTGGCTTGGG + Intronic
1023891080 7:44392521-44392543 CAGCCCTGGACACCTGTCTCAGG - Intronic
1023956889 7:44893735-44893757 CAGCACGGGGTGCCTGGCCTGGG - Intergenic
1024222417 7:47298992-47299014 CAGCCCTGGGTCCCTTGCATGGG - Intronic
1024842643 7:53604358-53604380 CAACCCTGGATACTTGGATTGGG - Intergenic
1027863497 7:83615849-83615871 CAGCCCTTGGTATTTCGCTTTGG - Intronic
1031996525 7:128235589-128235611 CAGCCCTGGGTACCTGGGCAGGG + Intergenic
1032711744 7:134466870-134466892 CTTGCCTGGGTACCTGGCCTCGG - Intergenic
1035096532 7:156360479-156360501 AAGCCCTGACTGCCTGGCTTGGG - Intergenic
1035122942 7:156583955-156583977 GAGCACTGGGAACATGGCTTTGG - Intergenic
1036816848 8:11908788-11908810 TAGTCCTTGGTCCCTGGCTTGGG + Intergenic
1044607106 8:94057297-94057319 TATCCCTAGGTACCTGGCTTTGG + Intergenic
1044705444 8:95004112-95004134 CAGACCTGGCTTCCTGGCTGGGG + Intronic
1046756164 8:117974762-117974784 CAGCCCTCACTACCTGGATTTGG + Intronic
1048957581 8:139549538-139549560 TAGTCCTTGGTTCCTGGCTTGGG + Intergenic
1049180688 8:141220605-141220627 CAGGCCTGGGTCCCGGGCTCTGG - Intronic
1049247939 8:141572618-141572640 AACCTCTGGGTACCTGGCTGCGG + Intergenic
1049711112 8:144063760-144063782 CAGCTCCGGGTTCCTGGCTGAGG - Intronic
1049848907 8:144820398-144820420 CATCCCTGAGCACCTGGCATCGG + Intergenic
1050327761 9:4514449-4514471 CCTCCCTGGTTATCTGGCTTGGG + Intronic
1052862366 9:33444899-33444921 CAGCCCTGGGTCCCGGGCTGGGG - Intronic
1056754350 9:89372749-89372771 GAGCCCAGGGTACCATGCTTGGG + Intronic
1059664684 9:116435272-116435294 AAGCCCTGGGCTCCTGGCTTTGG + Intronic
1060807641 9:126587772-126587794 AAGCCCTGGGAAGCGGGCTTGGG - Intergenic
1060823379 9:126673908-126673930 CAGGCCTGTGTACCTGGCCACGG - Intronic
1060909035 9:127334104-127334126 CTGCCCTGGGTAGCTGGGTGGGG + Intronic
1061666818 9:132164839-132164861 GAGCCCTGGGGCCCTGGCTGGGG + Intronic
1061952462 9:133944019-133944041 CAGACCTGGGCTCCTGGCTCTGG - Intronic
1062224404 9:135441309-135441331 TAGTCCTTGGTCCCTGGCTTGGG + Intergenic
1062526546 9:136980184-136980206 CAGCCCTGGGGGTCTGGGTTCGG - Exonic
1062538799 9:137032433-137032455 CAGGCCTGGGTAGCTGGGTGGGG - Exonic
1185909742 X:3970676-3970698 TAGTCCTTGGTCCCTGGCTTAGG - Intergenic
1190426063 X:50335437-50335459 TAGTCCTTGGTCCCTGGCTTAGG + Intronic
1191036241 X:56028930-56028952 TAGTCCTTGGTCCCTGGCTTGGG + Intergenic
1195499668 X:105580463-105580485 CTGCCCTGGGTCCCTGGTTAAGG - Intronic
1195676167 X:107508669-107508691 GAGCTCTGGGCAACTGGCTTGGG - Intergenic
1195763948 X:108276669-108276691 CAGACCTGAGCACCTGGCTCAGG + Intronic
1198059104 X:133025918-133025940 TGCCCCTGGGTGCCTGGCTTTGG + Exonic
1201554911 Y:15257534-15257556 AAGTCCTTGGTCCCTGGCTTAGG - Intergenic
1201680714 Y:16641543-16641565 TAGTCCTTGGTCCCTGGCTTGGG + Intergenic