ID: 968964843

View in Genome Browser
Species Human (GRCh38)
Location 4:3764670-3764692
Sequence ACAGGCTCTGAGGCTAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968964839_968964843 6 Left 968964839 4:3764641-3764663 CCCAGTAGGGCTGAGCAGCAGAG No data
Right 968964843 4:3764670-3764692 ACAGGCTCTGAGGCTAAAGCTGG No data
968964838_968964843 7 Left 968964838 4:3764640-3764662 CCCCAGTAGGGCTGAGCAGCAGA No data
Right 968964843 4:3764670-3764692 ACAGGCTCTGAGGCTAAAGCTGG No data
968964840_968964843 5 Left 968964840 4:3764642-3764664 CCAGTAGGGCTGAGCAGCAGAGA No data
Right 968964843 4:3764670-3764692 ACAGGCTCTGAGGCTAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968964843 Original CRISPR ACAGGCTCTGAGGCTAAAGC TGG Intergenic
No off target data available for this crispr