ID: 968968281

View in Genome Browser
Species Human (GRCh38)
Location 4:3780575-3780597
Sequence CTGGAGAAGGAGAGGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968968273_968968281 10 Left 968968273 4:3780542-3780564 CCCAGCCGGCAGGAGGATGGGGC No data
Right 968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG No data
968968269_968968281 12 Left 968968269 4:3780540-3780562 CCCCCAGCCGGCAGGAGGATGGG No data
Right 968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG No data
968968271_968968281 11 Left 968968271 4:3780541-3780563 CCCCAGCCGGCAGGAGGATGGGG No data
Right 968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG No data
968968263_968968281 23 Left 968968263 4:3780529-3780551 CCTCGGCCCAGCCCCCAGCCGGC No data
Right 968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG No data
968968261_968968281 30 Left 968968261 4:3780522-3780544 CCAGAGGCCTCGGCCCAGCCCCC No data
Right 968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG No data
968968267_968968281 16 Left 968968267 4:3780536-3780558 CCAGCCCCCAGCCGGCAGGAGGA No data
Right 968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG No data
968968265_968968281 17 Left 968968265 4:3780535-3780557 CCCAGCCCCCAGCCGGCAGGAGG No data
Right 968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG No data
968968275_968968281 5 Left 968968275 4:3780547-3780569 CCGGCAGGAGGATGGGGCACCTC No data
Right 968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG No data
968968274_968968281 9 Left 968968274 4:3780543-3780565 CCAGCCGGCAGGAGGATGGGGCA No data
Right 968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968968281 Original CRISPR CTGGAGAAGGAGAGGCCCTG TGG Intergenic
No off target data available for this crispr