ID: 968969565

View in Genome Browser
Species Human (GRCh38)
Location 4:3786556-3786578
Sequence AAGCAGAGAGAGAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968969557_968969565 13 Left 968969557 4:3786520-3786542 CCAGGTCCCTCCTGGAAAGTGGG No data
Right 968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG No data
968969561_968969565 3 Left 968969561 4:3786530-3786552 CCTGGAAAGTGGGTTTCTGAACA No data
Right 968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG No data
968969559_968969565 7 Left 968969559 4:3786526-3786548 CCCTCCTGGAAAGTGGGTTTCTG No data
Right 968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG No data
968969560_968969565 6 Left 968969560 4:3786527-3786549 CCTCCTGGAAAGTGGGTTTCTGA No data
Right 968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968969565 Original CRISPR AAGCAGAGAGAGAAAGAGGA GGG Intergenic
No off target data available for this crispr