ID: 968975653

View in Genome Browser
Species Human (GRCh38)
Location 4:3820910-3820932
Sequence CGGGAAGTTCCCTCCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968975653_968975661 -2 Left 968975653 4:3820910-3820932 CCCACCCAGGAGGGAACTTCCCG No data
Right 968975661 4:3820931-3820953 CGGAGGCCAAGACCTTGAGCTGG No data
968975653_968975664 14 Left 968975653 4:3820910-3820932 CCCACCCAGGAGGGAACTTCCCG No data
Right 968975664 4:3820947-3820969 GAGCTGGATTGTCAACAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968975653 Original CRISPR CGGGAAGTTCCCTCCTGGGT GGG (reversed) Intergenic
No off target data available for this crispr