ID: 968975661

View in Genome Browser
Species Human (GRCh38)
Location 4:3820931-3820953
Sequence CGGAGGCCAAGACCTTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968975658_968975661 -7 Left 968975658 4:3820915-3820937 CCAGGAGGGAACTTCCCGGAGGC No data
Right 968975661 4:3820931-3820953 CGGAGGCCAAGACCTTGAGCTGG No data
968975654_968975661 -3 Left 968975654 4:3820911-3820933 CCACCCAGGAGGGAACTTCCCGG No data
Right 968975661 4:3820931-3820953 CGGAGGCCAAGACCTTGAGCTGG No data
968975645_968975661 29 Left 968975645 4:3820879-3820901 CCGGGCCCTGGGAGTGCACAGAA No data
Right 968975661 4:3820931-3820953 CGGAGGCCAAGACCTTGAGCTGG No data
968975656_968975661 -6 Left 968975656 4:3820914-3820936 CCCAGGAGGGAACTTCCCGGAGG No data
Right 968975661 4:3820931-3820953 CGGAGGCCAAGACCTTGAGCTGG No data
968975653_968975661 -2 Left 968975653 4:3820910-3820932 CCCACCCAGGAGGGAACTTCCCG No data
Right 968975661 4:3820931-3820953 CGGAGGCCAAGACCTTGAGCTGG No data
968975648_968975661 24 Left 968975648 4:3820884-3820906 CCCTGGGAGTGCACAGAAAGGGA No data
Right 968975661 4:3820931-3820953 CGGAGGCCAAGACCTTGAGCTGG No data
968975649_968975661 23 Left 968975649 4:3820885-3820907 CCTGGGAGTGCACAGAAAGGGAA No data
Right 968975661 4:3820931-3820953 CGGAGGCCAAGACCTTGAGCTGG No data
968975644_968975661 30 Left 968975644 4:3820878-3820900 CCCGGGCCCTGGGAGTGCACAGA No data
Right 968975661 4:3820931-3820953 CGGAGGCCAAGACCTTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968975661 Original CRISPR CGGAGGCCAAGACCTTGAGC TGG Intergenic
No off target data available for this crispr