ID: 968975664

View in Genome Browser
Species Human (GRCh38)
Location 4:3820947-3820969
Sequence GAGCTGGATTGTCAACAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968975658_968975664 9 Left 968975658 4:3820915-3820937 CCAGGAGGGAACTTCCCGGAGGC No data
Right 968975664 4:3820947-3820969 GAGCTGGATTGTCAACAATAAGG No data
968975656_968975664 10 Left 968975656 4:3820914-3820936 CCCAGGAGGGAACTTCCCGGAGG No data
Right 968975664 4:3820947-3820969 GAGCTGGATTGTCAACAATAAGG No data
968975660_968975664 -6 Left 968975660 4:3820930-3820952 CCGGAGGCCAAGACCTTGAGCTG No data
Right 968975664 4:3820947-3820969 GAGCTGGATTGTCAACAATAAGG No data
968975659_968975664 -5 Left 968975659 4:3820929-3820951 CCCGGAGGCCAAGACCTTGAGCT No data
Right 968975664 4:3820947-3820969 GAGCTGGATTGTCAACAATAAGG No data
968975653_968975664 14 Left 968975653 4:3820910-3820932 CCCACCCAGGAGGGAACTTCCCG No data
Right 968975664 4:3820947-3820969 GAGCTGGATTGTCAACAATAAGG No data
968975654_968975664 13 Left 968975654 4:3820911-3820933 CCACCCAGGAGGGAACTTCCCGG No data
Right 968975664 4:3820947-3820969 GAGCTGGATTGTCAACAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968975664 Original CRISPR GAGCTGGATTGTCAACAATA AGG Intergenic
No off target data available for this crispr