ID: 968975974

View in Genome Browser
Species Human (GRCh38)
Location 4:3822235-3822257
Sequence GGGGCGTGTAGGAGGTTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968975974_968975979 -5 Left 968975974 4:3822235-3822257 CCCCGCAACCTCCTACACGCCCC No data
Right 968975979 4:3822253-3822275 GCCCCGTCTCCCTCTCCATCTGG No data
968975974_968975989 25 Left 968975974 4:3822235-3822257 CCCCGCAACCTCCTACACGCCCC No data
Right 968975989 4:3822283-3822305 GTCCTCAGAAGGCTGCACTCAGG No data
968975974_968975986 14 Left 968975974 4:3822235-3822257 CCCCGCAACCTCCTACACGCCCC No data
Right 968975986 4:3822272-3822294 CTGGTCTTCCCGTCCTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968975974 Original CRISPR GGGGCGTGTAGGAGGTTGCG GGG (reversed) Intergenic
No off target data available for this crispr