ID: 968976427

View in Genome Browser
Species Human (GRCh38)
Location 4:3824515-3824537
Sequence CGGGTAGAGAAAGCCTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968976427_968976435 11 Left 968976427 4:3824515-3824537 CCTTCAAAGGCTTTCTCTACCCG No data
Right 968976435 4:3824549-3824571 CCACCTTGGCCCCTGTCTTCAGG No data
968976427_968976436 12 Left 968976427 4:3824515-3824537 CCTTCAAAGGCTTTCTCTACCCG No data
Right 968976436 4:3824550-3824572 CACCTTGGCCCCTGTCTTCAGGG No data
968976427_968976431 -3 Left 968976427 4:3824515-3824537 CCTTCAAAGGCTTTCTCTACCCG No data
Right 968976431 4:3824535-3824557 CCGGCTCCTGCCAGCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968976427 Original CRISPR CGGGTAGAGAAAGCCTTTGA AGG (reversed) Intergenic