ID: 968976431

View in Genome Browser
Species Human (GRCh38)
Location 4:3824535-3824557
Sequence CCGGCTCCTGCCAGCCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968976427_968976431 -3 Left 968976427 4:3824515-3824537 CCTTCAAAGGCTTTCTCTACCCG No data
Right 968976431 4:3824535-3824557 CCGGCTCCTGCCAGCCACCTTGG No data
968976423_968976431 19 Left 968976423 4:3824493-3824515 CCATGGCACTCTCTCACCACCTC No data
Right 968976431 4:3824535-3824557 CCGGCTCCTGCCAGCCACCTTGG No data
968976425_968976431 3 Left 968976425 4:3824509-3824531 CCACCTCCTTCAAAGGCTTTCTC No data
Right 968976431 4:3824535-3824557 CCGGCTCCTGCCAGCCACCTTGG No data
968976426_968976431 0 Left 968976426 4:3824512-3824534 CCTCCTTCAAAGGCTTTCTCTAC No data
Right 968976431 4:3824535-3824557 CCGGCTCCTGCCAGCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968976431 Original CRISPR CCGGCTCCTGCCAGCCACCT TGG Intergenic
No off target data available for this crispr