ID: 968976436

View in Genome Browser
Species Human (GRCh38)
Location 4:3824550-3824572
Sequence CACCTTGGCCCCTGTCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968976429_968976436 -7 Left 968976429 4:3824534-3824556 CCCGGCTCCTGCCAGCCACCTTG No data
Right 968976436 4:3824550-3824572 CACCTTGGCCCCTGTCTTCAGGG No data
968976430_968976436 -8 Left 968976430 4:3824535-3824557 CCGGCTCCTGCCAGCCACCTTGG No data
Right 968976436 4:3824550-3824572 CACCTTGGCCCCTGTCTTCAGGG No data
968976425_968976436 18 Left 968976425 4:3824509-3824531 CCACCTCCTTCAAAGGCTTTCTC No data
Right 968976436 4:3824550-3824572 CACCTTGGCCCCTGTCTTCAGGG No data
968976426_968976436 15 Left 968976426 4:3824512-3824534 CCTCCTTCAAAGGCTTTCTCTAC No data
Right 968976436 4:3824550-3824572 CACCTTGGCCCCTGTCTTCAGGG No data
968976427_968976436 12 Left 968976427 4:3824515-3824537 CCTTCAAAGGCTTTCTCTACCCG No data
Right 968976436 4:3824550-3824572 CACCTTGGCCCCTGTCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968976436 Original CRISPR CACCTTGGCCCCTGTCTTCA GGG Intergenic
No off target data available for this crispr