ID: 968977118

View in Genome Browser
Species Human (GRCh38)
Location 4:3827809-3827831
Sequence GAGGCTGGTCCTCCACCATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968977118_968977130 16 Left 968977118 4:3827809-3827831 CCCGATGGTGGAGGACCAGCCTC No data
Right 968977130 4:3827848-3827870 ACCCAGCCCTCTGCCCAGATGGG No data
968977118_968977134 18 Left 968977118 4:3827809-3827831 CCCGATGGTGGAGGACCAGCCTC No data
Right 968977134 4:3827850-3827872 CCAGCCCTCTGCCCAGATGGGGG No data
968977118_968977132 17 Left 968977118 4:3827809-3827831 CCCGATGGTGGAGGACCAGCCTC No data
Right 968977132 4:3827849-3827871 CCCAGCCCTCTGCCCAGATGGGG No data
968977118_968977125 -9 Left 968977118 4:3827809-3827831 CCCGATGGTGGAGGACCAGCCTC No data
Right 968977125 4:3827823-3827845 ACCAGCCTCACAGGGGGCTTGGG No data
968977118_968977124 -10 Left 968977118 4:3827809-3827831 CCCGATGGTGGAGGACCAGCCTC No data
Right 968977124 4:3827822-3827844 GACCAGCCTCACAGGGGGCTTGG No data
968977118_968977129 15 Left 968977118 4:3827809-3827831 CCCGATGGTGGAGGACCAGCCTC No data
Right 968977129 4:3827847-3827869 CACCCAGCCCTCTGCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968977118 Original CRISPR GAGGCTGGTCCTCCACCATC GGG (reversed) Intergenic
No off target data available for this crispr