ID: 968977145

View in Genome Browser
Species Human (GRCh38)
Location 4:3827891-3827913
Sequence AGTCAGGGGCCTGGGCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968977145_968977156 14 Left 968977145 4:3827891-3827913 CCAGGGAGCCCAGGCCCCTGACT No data
Right 968977156 4:3827928-3827950 GCAGCCCCATCCCTCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968977145 Original CRISPR AGTCAGGGGCCTGGGCTCCC TGG (reversed) Intergenic
No off target data available for this crispr