ID: 968977385

View in Genome Browser
Species Human (GRCh38)
Location 4:3829093-3829115
Sequence GGTCAGAGCTTGTGGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968977385_968977390 -10 Left 968977385 4:3829093-3829115 CCCTGCTTCCACAAGCTCTGACC No data
Right 968977390 4:3829106-3829128 AGCTCTGACCCAGGAGACCCGGG No data
968977385_968977393 1 Left 968977385 4:3829093-3829115 CCCTGCTTCCACAAGCTCTGACC No data
Right 968977393 4:3829117-3829139 AGGAGACCCGGGACAAGCCCAGG No data
968977385_968977399 26 Left 968977385 4:3829093-3829115 CCCTGCTTCCACAAGCTCTGACC No data
Right 968977399 4:3829142-3829164 TCTGCATTTGAACCAGGTCCAGG No data
968977385_968977400 27 Left 968977385 4:3829093-3829115 CCCTGCTTCCACAAGCTCTGACC No data
Right 968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG No data
968977385_968977398 20 Left 968977385 4:3829093-3829115 CCCTGCTTCCACAAGCTCTGACC No data
Right 968977398 4:3829136-3829158 CAGGAGTCTGCATTTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968977385 Original CRISPR GGTCAGAGCTTGTGGAAGCA GGG (reversed) Intergenic
No off target data available for this crispr