ID: 968977386

View in Genome Browser
Species Human (GRCh38)
Location 4:3829094-3829116
Sequence GGGTCAGAGCTTGTGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968977386_968977399 25 Left 968977386 4:3829094-3829116 CCTGCTTCCACAAGCTCTGACCC No data
Right 968977399 4:3829142-3829164 TCTGCATTTGAACCAGGTCCAGG No data
968977386_968977400 26 Left 968977386 4:3829094-3829116 CCTGCTTCCACAAGCTCTGACCC No data
Right 968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG No data
968977386_968977398 19 Left 968977386 4:3829094-3829116 CCTGCTTCCACAAGCTCTGACCC No data
Right 968977398 4:3829136-3829158 CAGGAGTCTGCATTTGAACCAGG No data
968977386_968977393 0 Left 968977386 4:3829094-3829116 CCTGCTTCCACAAGCTCTGACCC No data
Right 968977393 4:3829117-3829139 AGGAGACCCGGGACAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968977386 Original CRISPR GGGTCAGAGCTTGTGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr