ID: 968977388

View in Genome Browser
Species Human (GRCh38)
Location 4:3829101-3829123
Sequence GTCTCCTGGGTCAGAGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968977388_968977398 12 Left 968977388 4:3829101-3829123 CCACAAGCTCTGACCCAGGAGAC No data
Right 968977398 4:3829136-3829158 CAGGAGTCTGCATTTGAACCAGG No data
968977388_968977399 18 Left 968977388 4:3829101-3829123 CCACAAGCTCTGACCCAGGAGAC No data
Right 968977399 4:3829142-3829164 TCTGCATTTGAACCAGGTCCAGG No data
968977388_968977400 19 Left 968977388 4:3829101-3829123 CCACAAGCTCTGACCCAGGAGAC No data
Right 968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG No data
968977388_968977393 -7 Left 968977388 4:3829101-3829123 CCACAAGCTCTGACCCAGGAGAC No data
Right 968977393 4:3829117-3829139 AGGAGACCCGGGACAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968977388 Original CRISPR GTCTCCTGGGTCAGAGCTTG TGG (reversed) Intergenic
No off target data available for this crispr