ID: 968977391

View in Genome Browser
Species Human (GRCh38)
Location 4:3829114-3829136
Sequence GGGCTTGTCCCGGGTCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968977391_968977402 18 Left 968977391 4:3829114-3829136 CCCAGGAGACCCGGGACAAGCCC No data
Right 968977402 4:3829155-3829177 CAGGTCCAGGGAATTGTCAGCGG No data
968977391_968977398 -1 Left 968977391 4:3829114-3829136 CCCAGGAGACCCGGGACAAGCCC No data
Right 968977398 4:3829136-3829158 CAGGAGTCTGCATTTGAACCAGG No data
968977391_968977400 6 Left 968977391 4:3829114-3829136 CCCAGGAGACCCGGGACAAGCCC No data
Right 968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG No data
968977391_968977399 5 Left 968977391 4:3829114-3829136 CCCAGGAGACCCGGGACAAGCCC No data
Right 968977399 4:3829142-3829164 TCTGCATTTGAACCAGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968977391 Original CRISPR GGGCTTGTCCCGGGTCTCCT GGG (reversed) Intergenic
No off target data available for this crispr