ID: 968977392

View in Genome Browser
Species Human (GRCh38)
Location 4:3829115-3829137
Sequence TGGGCTTGTCCCGGGTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968977392_968977398 -2 Left 968977392 4:3829115-3829137 CCAGGAGACCCGGGACAAGCCCA No data
Right 968977398 4:3829136-3829158 CAGGAGTCTGCATTTGAACCAGG No data
968977392_968977399 4 Left 968977392 4:3829115-3829137 CCAGGAGACCCGGGACAAGCCCA No data
Right 968977399 4:3829142-3829164 TCTGCATTTGAACCAGGTCCAGG No data
968977392_968977400 5 Left 968977392 4:3829115-3829137 CCAGGAGACCCGGGACAAGCCCA No data
Right 968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG No data
968977392_968977402 17 Left 968977392 4:3829115-3829137 CCAGGAGACCCGGGACAAGCCCA No data
Right 968977402 4:3829155-3829177 CAGGTCCAGGGAATTGTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968977392 Original CRISPR TGGGCTTGTCCCGGGTCTCC TGG (reversed) Intergenic
No off target data available for this crispr