ID: 968977395

View in Genome Browser
Species Human (GRCh38)
Location 4:3829124-3829146
Sequence GCAGACTCCTGGGCTTGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968977395_968977400 -4 Left 968977395 4:3829124-3829146 CCGGGACAAGCCCAGGAGTCTGC No data
Right 968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG No data
968977395_968977402 8 Left 968977395 4:3829124-3829146 CCGGGACAAGCCCAGGAGTCTGC No data
Right 968977402 4:3829155-3829177 CAGGTCCAGGGAATTGTCAGCGG No data
968977395_968977399 -5 Left 968977395 4:3829124-3829146 CCGGGACAAGCCCAGGAGTCTGC No data
Right 968977399 4:3829142-3829164 TCTGCATTTGAACCAGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968977395 Original CRISPR GCAGACTCCTGGGCTTGTCC CGG (reversed) Intergenic
No off target data available for this crispr