ID: 968977400

View in Genome Browser
Species Human (GRCh38)
Location 4:3829143-3829165
Sequence CTGCATTTGAACCAGGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968977386_968977400 26 Left 968977386 4:3829094-3829116 CCTGCTTCCACAAGCTCTGACCC No data
Right 968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG No data
968977394_968977400 -3 Left 968977394 4:3829123-3829145 CCCGGGACAAGCCCAGGAGTCTG No data
Right 968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG No data
968977395_968977400 -4 Left 968977395 4:3829124-3829146 CCGGGACAAGCCCAGGAGTCTGC No data
Right 968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG No data
968977385_968977400 27 Left 968977385 4:3829093-3829115 CCCTGCTTCCACAAGCTCTGACC No data
Right 968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG No data
968977388_968977400 19 Left 968977388 4:3829101-3829123 CCACAAGCTCTGACCCAGGAGAC No data
Right 968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG No data
968977391_968977400 6 Left 968977391 4:3829114-3829136 CCCAGGAGACCCGGGACAAGCCC No data
Right 968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG No data
968977392_968977400 5 Left 968977392 4:3829115-3829137 CCAGGAGACCCGGGACAAGCCCA No data
Right 968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968977400 Original CRISPR CTGCATTTGAACCAGGTCCA GGG Intergenic
No off target data available for this crispr