ID: 968983728

View in Genome Browser
Species Human (GRCh38)
Location 4:3864525-3864547
Sequence GGGCATCCGCGGCCCTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968983722_968983728 -5 Left 968983722 4:3864507-3864529 CCGGGAGGCCAAGGCCATGGGCA No data
Right 968983728 4:3864525-3864547 GGGCATCCGCGGCCCTGGGCTGG No data
968983721_968983728 -4 Left 968983721 4:3864506-3864528 CCCGGGAGGCCAAGGCCATGGGC No data
Right 968983728 4:3864525-3864547 GGGCATCCGCGGCCCTGGGCTGG No data
968983709_968983728 28 Left 968983709 4:3864474-3864496 CCTGCACTTGGCTCTGACTGCAA No data
Right 968983728 4:3864525-3864547 GGGCATCCGCGGCCCTGGGCTGG No data
968983717_968983728 -2 Left 968983717 4:3864504-3864526 CCCCCGGGAGGCCAAGGCCATGG No data
Right 968983728 4:3864525-3864547 GGGCATCCGCGGCCCTGGGCTGG No data
968983716_968983728 -1 Left 968983716 4:3864503-3864525 CCCCCCGGGAGGCCAAGGCCATG No data
Right 968983728 4:3864525-3864547 GGGCATCCGCGGCCCTGGGCTGG No data
968983719_968983728 -3 Left 968983719 4:3864505-3864527 CCCCGGGAGGCCAAGGCCATGGG No data
Right 968983728 4:3864525-3864547 GGGCATCCGCGGCCCTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968983728 Original CRISPR GGGCATCCGCGGCCCTGGGC TGG Intergenic