ID: 968993852

View in Genome Browser
Species Human (GRCh38)
Location 4:3933046-3933068
Sequence GTGTGAAGAGACCACCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2941
Summary {0: 1170, 1: 1149, 2: 398, 3: 94, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968993852_968993854 -5 Left 968993852 4:3933046-3933068 CCTGTTTGGTGGTCTCTTCACAC 0: 1170
1: 1149
2: 398
3: 94
4: 130
Right 968993854 4:3933064-3933086 CACACGGACGTGCATGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968993852 Original CRISPR GTGTGAAGAGACCACCAAAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr