ID: 968993854

View in Genome Browser
Species Human (GRCh38)
Location 4:3933064-3933086
Sequence CACACGGACGTGCATGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968993852_968993854 -5 Left 968993852 4:3933046-3933068 CCTGTTTGGTGGTCTCTTCACAC 0: 1170
1: 1149
2: 398
3: 94
4: 130
Right 968993854 4:3933064-3933086 CACACGGACGTGCATGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968993854 Original CRISPR CACACGGACGTGCATGAAAC TGG Intergenic
No off target data available for this crispr