ID: 968995324

View in Genome Browser
Species Human (GRCh38)
Location 4:3941658-3941680
Sequence AAACTGCAGCCCGGCCCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968995324_968995334 25 Left 968995324 4:3941658-3941680 CCGGGTGGGCCGGGCTGCAGTTT No data
Right 968995334 4:3941706-3941728 GAGTGGGCAAAGGGAGCTTCTGG No data
968995324_968995332 15 Left 968995324 4:3941658-3941680 CCGGGTGGGCCGGGCTGCAGTTT No data
Right 968995332 4:3941696-3941718 TCAGGTAGGTGAGTGGGCAAAGG No data
968995324_968995328 -3 Left 968995324 4:3941658-3941680 CCGGGTGGGCCGGGCTGCAGTTT No data
Right 968995328 4:3941678-3941700 TTTAGGAAGTGAGCAGGATCAGG No data
968995324_968995330 8 Left 968995324 4:3941658-3941680 CCGGGTGGGCCGGGCTGCAGTTT No data
Right 968995330 4:3941689-3941711 AGCAGGATCAGGTAGGTGAGTGG No data
968995324_968995333 16 Left 968995324 4:3941658-3941680 CCGGGTGGGCCGGGCTGCAGTTT No data
Right 968995333 4:3941697-3941719 CAGGTAGGTGAGTGGGCAAAGGG No data
968995324_968995335 26 Left 968995324 4:3941658-3941680 CCGGGTGGGCCGGGCTGCAGTTT No data
Right 968995335 4:3941707-3941729 AGTGGGCAAAGGGAGCTTCTGGG No data
968995324_968995329 1 Left 968995324 4:3941658-3941680 CCGGGTGGGCCGGGCTGCAGTTT No data
Right 968995329 4:3941682-3941704 GGAAGTGAGCAGGATCAGGTAGG No data
968995324_968995327 -9 Left 968995324 4:3941658-3941680 CCGGGTGGGCCGGGCTGCAGTTT No data
Right 968995327 4:3941672-3941694 CTGCAGTTTAGGAAGTGAGCAGG No data
968995324_968995331 9 Left 968995324 4:3941658-3941680 CCGGGTGGGCCGGGCTGCAGTTT No data
Right 968995331 4:3941690-3941712 GCAGGATCAGGTAGGTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968995324 Original CRISPR AAACTGCAGCCCGGCCCACC CGG (reversed) Intergenic
No off target data available for this crispr