ID: 968995327

View in Genome Browser
Species Human (GRCh38)
Location 4:3941672-3941694
Sequence CTGCAGTTTAGGAAGTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968995324_968995327 -9 Left 968995324 4:3941658-3941680 CCGGGTGGGCCGGGCTGCAGTTT No data
Right 968995327 4:3941672-3941694 CTGCAGTTTAGGAAGTGAGCAGG No data
968995318_968995327 9 Left 968995318 4:3941640-3941662 CCACAAATGACGCTGGAGCCGGG No data
Right 968995327 4:3941672-3941694 CTGCAGTTTAGGAAGTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968995327 Original CRISPR CTGCAGTTTAGGAAGTGAGC AGG Intergenic
No off target data available for this crispr