ID: 968996363

View in Genome Browser
Species Human (GRCh38)
Location 4:3948154-3948176
Sequence CTCCCACGGCACCACAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968996363_968996367 -4 Left 968996363 4:3948154-3948176 CCAGGCCTGTGGTGCCGTGGGAG No data
Right 968996367 4:3948173-3948195 GGAGATGATGGCTGTGCTCTTGG No data
968996363_968996369 21 Left 968996363 4:3948154-3948176 CCAGGCCTGTGGTGCCGTGGGAG No data
Right 968996369 4:3948198-3948220 AGTGTGACCGAGCCTCCCGAGGG 0: 3
1: 8
2: 2
3: 2
4: 41
968996363_968996368 20 Left 968996363 4:3948154-3948176 CCAGGCCTGTGGTGCCGTGGGAG No data
Right 968996368 4:3948197-3948219 GAGTGTGACCGAGCCTCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968996363 Original CRISPR CTCCCACGGCACCACAGGCC TGG (reversed) Intergenic
No off target data available for this crispr