ID: 968997549

View in Genome Browser
Species Human (GRCh38)
Location 4:3955396-3955418
Sequence TGGCGCCCTAGGAGAACGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 6, 2: 3, 3: 6, 4: 35}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968997549_968997557 -10 Left 968997549 4:3955396-3955418 CCCCGCGTTCTCCTAGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 35
Right 968997557 4:3955409-3955431 TAGGGCGCCATGGCGTGGGCGGG 0: 1
1: 0
2: 5
3: 11
4: 69
968997549_968997568 26 Left 968997549 4:3955396-3955418 CCCCGCGTTCTCCTAGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 35
Right 968997568 4:3955445-3955467 CGGGAGACCGGGCGGAAGCCGGG No data
968997549_968997567 25 Left 968997549 4:3955396-3955418 CCCCGCGTTCTCCTAGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 35
Right 968997567 4:3955444-3955466 CCGGGAGACCGGGCGGAAGCCGG No data
968997549_968997565 18 Left 968997549 4:3955396-3955418 CCCCGCGTTCTCCTAGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 35
Right 968997565 4:3955437-3955459 AGCGTTGCCGGGAGACCGGGCGG No data
968997549_968997564 15 Left 968997549 4:3955396-3955418 CCCCGCGTTCTCCTAGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 35
Right 968997564 4:3955434-3955456 CGCAGCGTTGCCGGGAGACCGGG No data
968997549_968997561 7 Left 968997549 4:3955396-3955418 CCCCGCGTTCTCCTAGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 35
Right 968997561 4:3955426-3955448 GGCGGGGCCGCAGCGTTGCCGGG No data
968997549_968997558 -9 Left 968997549 4:3955396-3955418 CCCCGCGTTCTCCTAGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 35
Right 968997558 4:3955410-3955432 AGGGCGCCATGGCGTGGGCGGGG 0: 1
1: 0
2: 6
3: 12
4: 147
968997549_968997560 6 Left 968997549 4:3955396-3955418 CCCCGCGTTCTCCTAGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 35
Right 968997560 4:3955425-3955447 GGGCGGGGCCGCAGCGTTGCCGG No data
968997549_968997563 14 Left 968997549 4:3955396-3955418 CCCCGCGTTCTCCTAGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 35
Right 968997563 4:3955433-3955455 CCGCAGCGTTGCCGGGAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968997549 Original CRISPR TGGCGCCCTAGGAGAACGCG GGG (reversed) Intergenic