ID: 969004497

View in Genome Browser
Species Human (GRCh38)
Location 4:4008388-4008410
Sequence ACCAAAACTGTCTCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969004497_969004503 7 Left 969004497 4:4008388-4008410 CCATGTCTGGAGACAGTTTTGGT No data
Right 969004503 4:4008418-4008440 GCTGGAGGAGGTGGTGCTCTTGG No data
969004497_969004505 18 Left 969004497 4:4008388-4008410 CCATGTCTGGAGACAGTTTTGGT No data
Right 969004505 4:4008429-4008451 TGGTGCTCTTGGCATCTAGTGGG No data
969004497_969004507 29 Left 969004497 4:4008388-4008410 CCATGTCTGGAGACAGTTTTGGT No data
Right 969004507 4:4008440-4008462 GCATCTAGTGGGTAGAGGCCAGG 0: 142
1: 512
2: 994
3: 1338
4: 1377
969004497_969004506 24 Left 969004497 4:4008388-4008410 CCATGTCTGGAGACAGTTTTGGT No data
Right 969004506 4:4008435-4008457 TCTTGGCATCTAGTGGGTAGAGG No data
969004497_969004502 -2 Left 969004497 4:4008388-4008410 CCATGTCTGGAGACAGTTTTGGT No data
Right 969004502 4:4008409-4008431 GTTGTTGCGGCTGGAGGAGGTGG No data
969004497_969004500 -8 Left 969004497 4:4008388-4008410 CCATGTCTGGAGACAGTTTTGGT No data
Right 969004500 4:4008403-4008425 GTTTTGGTTGTTGCGGCTGGAGG No data
969004497_969004504 17 Left 969004497 4:4008388-4008410 CCATGTCTGGAGACAGTTTTGGT No data
Right 969004504 4:4008428-4008450 GTGGTGCTCTTGGCATCTAGTGG No data
969004497_969004501 -5 Left 969004497 4:4008388-4008410 CCATGTCTGGAGACAGTTTTGGT No data
Right 969004501 4:4008406-4008428 TTGGTTGTTGCGGCTGGAGGAGG No data
969004497_969004508 30 Left 969004497 4:4008388-4008410 CCATGTCTGGAGACAGTTTTGGT No data
Right 969004508 4:4008441-4008463 CATCTAGTGGGTAGAGGCCAGGG 0: 156
1: 612
2: 1041
3: 1292
4: 1355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969004497 Original CRISPR ACCAAAACTGTCTCCAGACA TGG (reversed) Intergenic
No off target data available for this crispr