ID: 969004631

View in Genome Browser
Species Human (GRCh38)
Location 4:4009462-4009484
Sequence CAGTACATGGACCCCCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969004631_969004642 25 Left 969004631 4:4009462-4009484 CCAGTGAGGGGGTCCATGTACTG No data
Right 969004642 4:4009510-4009532 GATTGCCCTGGACTGAGTACTGG No data
969004631_969004641 13 Left 969004631 4:4009462-4009484 CCAGTGAGGGGGTCCATGTACTG No data
Right 969004641 4:4009498-4009520 AGATGGAGTTGGGATTGCCCTGG No data
969004631_969004643 26 Left 969004631 4:4009462-4009484 CCAGTGAGGGGGTCCATGTACTG No data
Right 969004643 4:4009511-4009533 ATTGCCCTGGACTGAGTACTGGG No data
969004631_969004636 2 Left 969004631 4:4009462-4009484 CCAGTGAGGGGGTCCATGTACTG No data
Right 969004636 4:4009487-4009509 GGTAGCCCCACAGATGGAGTTGG No data
969004631_969004637 3 Left 969004631 4:4009462-4009484 CCAGTGAGGGGGTCCATGTACTG No data
Right 969004637 4:4009488-4009510 GTAGCCCCACAGATGGAGTTGGG No data
969004631_969004635 -4 Left 969004631 4:4009462-4009484 CCAGTGAGGGGGTCCATGTACTG No data
Right 969004635 4:4009481-4009503 ACTGTGGGTAGCCCCACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969004631 Original CRISPR CAGTACATGGACCCCCTCAC TGG (reversed) Intergenic