ID: 969004634

View in Genome Browser
Species Human (GRCh38)
Location 4:4009475-4009497
Sequence GTGGGGCTACCCACAGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969004634_969004637 -10 Left 969004634 4:4009475-4009497 CCATGTACTGTGGGTAGCCCCAC No data
Right 969004637 4:4009488-4009510 GTAGCCCCACAGATGGAGTTGGG No data
969004634_969004641 0 Left 969004634 4:4009475-4009497 CCATGTACTGTGGGTAGCCCCAC No data
Right 969004641 4:4009498-4009520 AGATGGAGTTGGGATTGCCCTGG No data
969004634_969004643 13 Left 969004634 4:4009475-4009497 CCATGTACTGTGGGTAGCCCCAC No data
Right 969004643 4:4009511-4009533 ATTGCCCTGGACTGAGTACTGGG No data
969004634_969004642 12 Left 969004634 4:4009475-4009497 CCATGTACTGTGGGTAGCCCCAC No data
Right 969004642 4:4009510-4009532 GATTGCCCTGGACTGAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969004634 Original CRISPR GTGGGGCTACCCACAGTACA TGG (reversed) Intergenic