ID: 969004638

View in Genome Browser
Species Human (GRCh38)
Location 4:4009492-4009514
Sequence CAATCCCAACTCCATCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969004638_969004642 -5 Left 969004638 4:4009492-4009514 CCCCACAGATGGAGTTGGGATTG No data
Right 969004642 4:4009510-4009532 GATTGCCCTGGACTGAGTACTGG No data
969004638_969004643 -4 Left 969004638 4:4009492-4009514 CCCCACAGATGGAGTTGGGATTG No data
Right 969004643 4:4009511-4009533 ATTGCCCTGGACTGAGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969004638 Original CRISPR CAATCCCAACTCCATCTGTG GGG (reversed) Intergenic