ID: 969004639

View in Genome Browser
Species Human (GRCh38)
Location 4:4009493-4009515
Sequence GCAATCCCAACTCCATCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969004639_969004643 -5 Left 969004639 4:4009493-4009515 CCCACAGATGGAGTTGGGATTGC No data
Right 969004643 4:4009511-4009533 ATTGCCCTGGACTGAGTACTGGG No data
969004639_969004642 -6 Left 969004639 4:4009493-4009515 CCCACAGATGGAGTTGGGATTGC No data
Right 969004642 4:4009510-4009532 GATTGCCCTGGACTGAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969004639 Original CRISPR GCAATCCCAACTCCATCTGT GGG (reversed) Intergenic