ID: 969004640

View in Genome Browser
Species Human (GRCh38)
Location 4:4009494-4009516
Sequence GGCAATCCCAACTCCATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969004640_969004642 -7 Left 969004640 4:4009494-4009516 CCACAGATGGAGTTGGGATTGCC No data
Right 969004642 4:4009510-4009532 GATTGCCCTGGACTGAGTACTGG No data
969004640_969004643 -6 Left 969004640 4:4009494-4009516 CCACAGATGGAGTTGGGATTGCC No data
Right 969004643 4:4009511-4009533 ATTGCCCTGGACTGAGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969004640 Original CRISPR GGCAATCCCAACTCCATCTG TGG (reversed) Intergenic