ID: 969004641

View in Genome Browser
Species Human (GRCh38)
Location 4:4009498-4009520
Sequence AGATGGAGTTGGGATTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969004631_969004641 13 Left 969004631 4:4009462-4009484 CCAGTGAGGGGGTCCATGTACTG No data
Right 969004641 4:4009498-4009520 AGATGGAGTTGGGATTGCCCTGG No data
969004634_969004641 0 Left 969004634 4:4009475-4009497 CCATGTACTGTGGGTAGCCCCAC No data
Right 969004641 4:4009498-4009520 AGATGGAGTTGGGATTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969004641 Original CRISPR AGATGGAGTTGGGATTGCCC TGG Intergenic