ID: 969004642

View in Genome Browser
Species Human (GRCh38)
Location 4:4009510-4009532
Sequence GATTGCCCTGGACTGAGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969004631_969004642 25 Left 969004631 4:4009462-4009484 CCAGTGAGGGGGTCCATGTACTG No data
Right 969004642 4:4009510-4009532 GATTGCCCTGGACTGAGTACTGG No data
969004639_969004642 -6 Left 969004639 4:4009493-4009515 CCCACAGATGGAGTTGGGATTGC No data
Right 969004642 4:4009510-4009532 GATTGCCCTGGACTGAGTACTGG No data
969004640_969004642 -7 Left 969004640 4:4009494-4009516 CCACAGATGGAGTTGGGATTGCC No data
Right 969004642 4:4009510-4009532 GATTGCCCTGGACTGAGTACTGG No data
969004634_969004642 12 Left 969004634 4:4009475-4009497 CCATGTACTGTGGGTAGCCCCAC No data
Right 969004642 4:4009510-4009532 GATTGCCCTGGACTGAGTACTGG No data
969004638_969004642 -5 Left 969004638 4:4009492-4009514 CCCCACAGATGGAGTTGGGATTG No data
Right 969004642 4:4009510-4009532 GATTGCCCTGGACTGAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969004642 Original CRISPR GATTGCCCTGGACTGAGTAC TGG Intergenic