ID: 969004643

View in Genome Browser
Species Human (GRCh38)
Location 4:4009511-4009533
Sequence ATTGCCCTGGACTGAGTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969004634_969004643 13 Left 969004634 4:4009475-4009497 CCATGTACTGTGGGTAGCCCCAC No data
Right 969004643 4:4009511-4009533 ATTGCCCTGGACTGAGTACTGGG No data
969004640_969004643 -6 Left 969004640 4:4009494-4009516 CCACAGATGGAGTTGGGATTGCC No data
Right 969004643 4:4009511-4009533 ATTGCCCTGGACTGAGTACTGGG No data
969004631_969004643 26 Left 969004631 4:4009462-4009484 CCAGTGAGGGGGTCCATGTACTG No data
Right 969004643 4:4009511-4009533 ATTGCCCTGGACTGAGTACTGGG No data
969004639_969004643 -5 Left 969004639 4:4009493-4009515 CCCACAGATGGAGTTGGGATTGC No data
Right 969004643 4:4009511-4009533 ATTGCCCTGGACTGAGTACTGGG No data
969004638_969004643 -4 Left 969004638 4:4009492-4009514 CCCCACAGATGGAGTTGGGATTG No data
Right 969004643 4:4009511-4009533 ATTGCCCTGGACTGAGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969004643 Original CRISPR ATTGCCCTGGACTGAGTACT GGG Intergenic