ID: 969005007

View in Genome Browser
Species Human (GRCh38)
Location 4:4011953-4011975
Sequence TGGAGTGAAGGCAGGACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969004998_969005007 11 Left 969004998 4:4011919-4011941 CCTGGATAAATGCCAGGTGTAAT No data
Right 969005007 4:4011953-4011975 TGGAGTGAAGGCAGGACCCCTGG No data
969004992_969005007 27 Left 969004992 4:4011903-4011925 CCCCTTAGATTCCTGCCCTGGAT No data
Right 969005007 4:4011953-4011975 TGGAGTGAAGGCAGGACCCCTGG No data
969004996_969005007 16 Left 969004996 4:4011914-4011936 CCTGCCCTGGATAAATGCCAGGT No data
Right 969005007 4:4011953-4011975 TGGAGTGAAGGCAGGACCCCTGG No data
969004994_969005007 25 Left 969004994 4:4011905-4011927 CCTTAGATTCCTGCCCTGGATAA No data
Right 969005007 4:4011953-4011975 TGGAGTGAAGGCAGGACCCCTGG No data
969004999_969005007 -1 Left 969004999 4:4011931-4011953 CCAGGTGTAATCTCCTCTCCCCT No data
Right 969005007 4:4011953-4011975 TGGAGTGAAGGCAGGACCCCTGG No data
969004997_969005007 12 Left 969004997 4:4011918-4011940 CCCTGGATAAATGCCAGGTGTAA No data
Right 969005007 4:4011953-4011975 TGGAGTGAAGGCAGGACCCCTGG No data
969004993_969005007 26 Left 969004993 4:4011904-4011926 CCCTTAGATTCCTGCCCTGGATA No data
Right 969005007 4:4011953-4011975 TGGAGTGAAGGCAGGACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969005007 Original CRISPR TGGAGTGAAGGCAGGACCCC TGG Intergenic
No off target data available for this crispr