ID: 969014758

View in Genome Browser
Species Human (GRCh38)
Location 4:4096511-4096533
Sequence TCTGCACCCTGGTGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969014758_969014765 5 Left 969014758 4:4096511-4096533 CCCCCAGGACACCAGGGTGCAGA No data
Right 969014765 4:4096539-4096561 GTGAGTAAAAGAAAGAGAGGCGG No data
969014758_969014764 2 Left 969014758 4:4096511-4096533 CCCCCAGGACACCAGGGTGCAGA No data
Right 969014764 4:4096536-4096558 GGTGTGAGTAAAAGAAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969014758 Original CRISPR TCTGCACCCTGGTGTCCTGG GGG (reversed) Intergenic
No off target data available for this crispr