ID: 969016666

View in Genome Browser
Species Human (GRCh38)
Location 4:4107911-4107933
Sequence CTGTGTCTTGCATGATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969016657_969016666 26 Left 969016657 4:4107862-4107884 CCCCGAGAGGGTGGACATCGGCC No data
Right 969016666 4:4107911-4107933 CTGTGTCTTGCATGATTTGGAGG No data
969016660_969016666 5 Left 969016660 4:4107883-4107905 CCACAGCCACCTTGTCTTTGCTC No data
Right 969016666 4:4107911-4107933 CTGTGTCTTGCATGATTTGGAGG No data
969016662_969016666 -4 Left 969016662 4:4107892-4107914 CCTTGTCTTTGCTCTTACCCTGT No data
Right 969016666 4:4107911-4107933 CTGTGTCTTGCATGATTTGGAGG No data
969016658_969016666 25 Left 969016658 4:4107863-4107885 CCCGAGAGGGTGGACATCGGCCA No data
Right 969016666 4:4107911-4107933 CTGTGTCTTGCATGATTTGGAGG No data
969016659_969016666 24 Left 969016659 4:4107864-4107886 CCGAGAGGGTGGACATCGGCCAC No data
Right 969016666 4:4107911-4107933 CTGTGTCTTGCATGATTTGGAGG No data
969016661_969016666 -1 Left 969016661 4:4107889-4107911 CCACCTTGTCTTTGCTCTTACCC No data
Right 969016666 4:4107911-4107933 CTGTGTCTTGCATGATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969016666 Original CRISPR CTGTGTCTTGCATGATTTGG AGG Intergenic
No off target data available for this crispr