ID: 969020078

View in Genome Browser
Species Human (GRCh38)
Location 4:4134004-4134026
Sequence CATGTGGGCCCAACTGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969020068_969020078 13 Left 969020068 4:4133968-4133990 CCCTGTCTCGGTTTAGCCTTTGC 0: 26
1: 23
2: 21
3: 13
4: 244
Right 969020078 4:4134004-4134026 CATGTGGGCCCAACTGGGGGTGG No data
969020066_969020078 25 Left 969020066 4:4133956-4133978 CCAAGAGAGCTTCCCTGTCTCGG No data
Right 969020078 4:4134004-4134026 CATGTGGGCCCAACTGGGGGTGG No data
969020069_969020078 12 Left 969020069 4:4133969-4133991 CCTGTCTCGGTTTAGCCTTTGCA 0: 26
1: 25
2: 18
3: 8
4: 61
Right 969020078 4:4134004-4134026 CATGTGGGCCCAACTGGGGGTGG No data
969020070_969020078 -3 Left 969020070 4:4133984-4134006 CCTTTGCATATCCTCTCTTTCAT 0: 42
1: 22
2: 15
3: 41
4: 461
Right 969020078 4:4134004-4134026 CATGTGGGCCCAACTGGGGGTGG No data
969020065_969020078 29 Left 969020065 4:4133952-4133974 CCTTCCAAGAGAGCTTCCCTGTC 0: 41
1: 19
2: 7
3: 25
4: 193
Right 969020078 4:4134004-4134026 CATGTGGGCCCAACTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969020078 Original CRISPR CATGTGGGCCCAACTGGGGG TGG Intergenic
No off target data available for this crispr