ID: 969021662

View in Genome Browser
Species Human (GRCh38)
Location 4:4143420-4143442
Sequence GAGGAGGGAGGCTGAGTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969021653_969021662 4 Left 969021653 4:4143393-4143415 CCTAAGTCGTGGTAAACTGAGGC No data
Right 969021662 4:4143420-4143442 GAGGAGGGAGGCTGAGTCCGGGG No data
969021651_969021662 8 Left 969021651 4:4143389-4143411 CCGACCTAAGTCGTGGTAAACTG No data
Right 969021662 4:4143420-4143442 GAGGAGGGAGGCTGAGTCCGGGG No data
969021648_969021662 11 Left 969021648 4:4143386-4143408 CCCCCGACCTAAGTCGTGGTAAA No data
Right 969021662 4:4143420-4143442 GAGGAGGGAGGCTGAGTCCGGGG No data
969021649_969021662 10 Left 969021649 4:4143387-4143409 CCCCGACCTAAGTCGTGGTAAAC No data
Right 969021662 4:4143420-4143442 GAGGAGGGAGGCTGAGTCCGGGG No data
969021650_969021662 9 Left 969021650 4:4143388-4143410 CCCGACCTAAGTCGTGGTAAACT No data
Right 969021662 4:4143420-4143442 GAGGAGGGAGGCTGAGTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969021662 Original CRISPR GAGGAGGGAGGCTGAGTCCG GGG Intergenic
No off target data available for this crispr