ID: 969024340

View in Genome Browser
Species Human (GRCh38)
Location 4:4161595-4161617
Sequence AAAGGCCTATTGAACTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969024340_969024345 9 Left 969024340 4:4161595-4161617 CCCCAAGAGTTCAATAGGCCTTT No data
Right 969024345 4:4161627-4161649 TCACACTCCATGCACTTGAAGGG No data
969024340_969024344 8 Left 969024340 4:4161595-4161617 CCCCAAGAGTTCAATAGGCCTTT No data
Right 969024344 4:4161626-4161648 ATCACACTCCATGCACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969024340 Original CRISPR AAAGGCCTATTGAACTCTTG GGG (reversed) Intergenic
No off target data available for this crispr