ID: 969024344

View in Genome Browser
Species Human (GRCh38)
Location 4:4161626-4161648
Sequence ATCACACTCCATGCACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969024343_969024344 -10 Left 969024343 4:4161613-4161635 CCTTTTTCTTTCTATCACACTCC No data
Right 969024344 4:4161626-4161648 ATCACACTCCATGCACTTGAAGG No data
969024339_969024344 9 Left 969024339 4:4161594-4161616 CCCCCAAGAGTTCAATAGGCCTT No data
Right 969024344 4:4161626-4161648 ATCACACTCCATGCACTTGAAGG No data
969024342_969024344 6 Left 969024342 4:4161597-4161619 CCAAGAGTTCAATAGGCCTTTTT No data
Right 969024344 4:4161626-4161648 ATCACACTCCATGCACTTGAAGG No data
969024340_969024344 8 Left 969024340 4:4161595-4161617 CCCCAAGAGTTCAATAGGCCTTT No data
Right 969024344 4:4161626-4161648 ATCACACTCCATGCACTTGAAGG No data
969024341_969024344 7 Left 969024341 4:4161596-4161618 CCCAAGAGTTCAATAGGCCTTTT No data
Right 969024344 4:4161626-4161648 ATCACACTCCATGCACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969024344 Original CRISPR ATCACACTCCATGCACTTGA AGG Intergenic
No off target data available for this crispr