ID: 969025205

View in Genome Browser
Species Human (GRCh38)
Location 4:4167270-4167292
Sequence GAAGGACAACTGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969025205_969025214 20 Left 969025205 4:4167270-4167292 CCTTCCTCCATCAGTTGTCCTTC No data
Right 969025214 4:4167313-4167335 TTTTCTTCTTTAGAAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969025205 Original CRISPR GAAGGACAACTGATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr