ID: 969025741

View in Genome Browser
Species Human (GRCh38)
Location 4:4170721-4170743
Sequence GCTCGTTTACGACCCAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969025741_969025748 -7 Left 969025741 4:4170721-4170743 CCCGTTTTGGGTCGTAAACGAGC No data
Right 969025748 4:4170737-4170759 AACGAGCTGCGGAGGGAGGGTGG No data
969025741_969025749 -2 Left 969025741 4:4170721-4170743 CCCGTTTTGGGTCGTAAACGAGC No data
Right 969025749 4:4170742-4170764 GCTGCGGAGGGAGGGTGGAATGG No data
969025741_969025747 -10 Left 969025741 4:4170721-4170743 CCCGTTTTGGGTCGTAAACGAGC No data
Right 969025747 4:4170734-4170756 GTAAACGAGCTGCGGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969025741 Original CRISPR GCTCGTTTACGACCCAAAAC GGG (reversed) Intergenic
No off target data available for this crispr